https://daringfireball.net/projects/markdown/syntax#precode
syntax
\*literal asterisks\*
output
*literal asterisks*
--- | |
title: "The power of DRY" | |
output: html_document | |
--- | |
```{r setup, include=FALSE} | |
knitr::opts_chunk$set(echo = FALSE) | |
#rmarkdown::render("iwalk_script.Rmd") | |
library(dplyr) | |
library(forcats) |
https://daringfireball.net/projects/markdown/syntax#precode
syntax
\*literal asterisks\*
output
*literal asterisks*
Java.perform(function() { | |
var surface_view = Java.use('android.view.SurfaceView'); | |
var set_secure = surface_view.setSecure.overload('boolean'); | |
set_secure.implementation = function(flag){ | |
console.log("setSecure() flag called with args: " + flag); | |
set_secure.call(false); | |
}; |
I used to have a site bookmarked with a table of all these functions, but the link is dead. Here's a matrix of Option and Result conversion functions. These become second nature once you have used Rust for any significant length of time, but it's useful to have a table reference.
For each of the below:
T
is the value possibly contained in an input Ok
Result
or Some
Option
.U
is a new value created by transforming or replacing an input T
. Note that when
U
appears in methods like map
, U ?= T
, for example by calling<?php | |
/** | |
* get-pdoc.php - Scrape Canada Revenue Agency payroll deductions values | |
* | |
* This script takes an hourly amount, a number of hours, and a year, | |
* month and day of a pay period ending, and passes these to the | |
* Canada Revenue Agency Payroll Deductions Online Calculator | |
* (https://www.canada.ca/en/revenue-agency/services/e-services/e-services-businesses/payroll-deductions-online-calculator.html), | |
* returning the provincial tax, federal tax, CPP and EI amounts. | |
* |
<?php | |
# app/Http/Controllers/CaddyController.php | |
namespace App\Http\Controllers; | |
use App\Store; | |
use Illuminate\Http\Request; | |
class CaddyController extends Controller | |
{ |
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG |
Our main aim is to have a clean code, avoid common silly mistakes and reduce the load on engineers during PR reviews. This is a team effort and If anyone has something that’s generally applicable, let’s talk and decide whether it should be baked into our style guide— so everyone can benefit from it
The bad code creates a lot of distractions. It causes developers to waste time and energy navigating through functions, classes, and files, and pouring over code trying to understand it.
Working on a project where developers care about clean code makes it easy to understand its virtues; the developer can read the code from top to bottom in one go and clearly understand what it does. It makes code manageable and maintainable in the long term, isolating changes and increasing the efficiency of the team.
If you're using a high-end bluetooth headset on your Macbook Pro it's likely your mac is using an audio codec which favors battery efficiency over high quality. This results in a drastic degradation of sound, the SBC codec is the likely culprit, read more about it here.
C/C++ plugin
.clangd
plugin.clang
:/path/to/kernel_source$ make CC=clang defconfig
/path/to/kernel_source$ make CC=clang -j16
compile_commands.json
:/path/to/kernel_source$ python ./scripts/clang-tools/gen_compile_commands.py