Discover gists

Typing vagrant from the command line will display a list of all available commands.

Be sure that you are in the same directory as the Vagrantfile when running these commands!

Creating a VM

vagrant init -- Initialize Vagrant with a Vagrantfile and ./.vagrant directory, using no specified base image. Before you can do vagrant up, you'll need to specify a base image in the Vagrantfile.
vagrant init <boxpath> -- Initialize Vagrant with a specific box. To find a box, go to the public Vagrant box catalog. When you find one you like, just replace it's name with boxpath. For example, vagrant init ubuntu/trusty64.

vagrant up -- starts vagrant environment (also provisions only on the FIRST vagrant up)

	# ZSH
	sudo apt install zsh -y
	sudo apt-get install powerline fonts-powerline -y
	git clone https://github.com/robbyrussell/oh-my-zsh.git ~/.oh-my-zsh
	cp ~/.oh-my-zsh/templates/zshrc.zsh-template ~/.zshrc
	chsh -s /bin/zsh

	# REBOOT
	# sudo reboot

	{
	description = "Python Packages Example";

	inputs = {
	nixpkgs.url = "github:NixOS/nixpkgs/nixos-unstable";
	flake-utils.url = "github:numtide/flake-utils";
	};

	outputs = { self, nixpkgs, flake-utils }:
	flake-utils.lib.eachDefaultSystem

	#____ ____ __
	#\ \ / /____ _____/ \|_ ___________
	# \ Y // __ \_/ ___\ __\/ _ \_ __ \
	# \ /\ ___/\ \___\| \| ( <_> ) \| \/
	# \___/ \___ >\___ >__\| \____/\|__\|
	# \/ \/
	#--Licensed under GNU GPL 3
	#----Authored by Vector/NullArray
	#
	# Do't forget to run this as well.

	#!/usr/bin/env bash
	######################################################
	# ProtonVPN CLI
	# ProtonVPN Command-Line Tool
	#
	# Made with <3 for Linux + macOS.
	###
	#Author: Mazin Ahmed <Mazin AT ProtonMail DOT ch>
	######################################################
	version=1.1.2

	"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
	"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG"
	"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG

	; ----------------------------------------------------------------------------------------------------------------------
	; Name ..........: TrayIcon library
	; Description ...: Provide some useful functions to deal with Tray icons.
	; AHK Version ...: AHK_L 1.1.13.01 x32/64 Unicode
	; Original Author: Sean (http://goo.gl/dh0xIX) (http://www.autohotkey.com/forum/viewtopic.php?t=17314)
	; Update Author .: Cyruz (http://ciroprincipe.info) (http://ahkscript.org/boards/viewtopic.php?f=6&t=1229)
	; Mod Author ....: Fanatic Guru
	; License .......: WTFPL - http://www.wtfpl.net/txt/copying/
	; Version Date...: 2014 - 01 - 16
	; Note ..........: Many people have updated Sean's original work including me but Cyruz's version seemed the most straight

	Menu, MyMenu, Add, Item 1, Label
	Menu, MyMenu, Disable, Item 1
	Menu, MyMenu, Add, Item 2, Label
	DllCall("SetTimer", "Ptr", A_ScriptHwnd, "Ptr", id := 1, "UInt", 2000, "Ptr", RegisterCallback("MyTimer", "F"))
	Menu, MyMenu, Show
	Return

	Label() {
	MsgBox, % A_ThisMenuItem
	}