Skip to content

Instantly share code, notes, and snippets.

Discover gists

@Aizazahmed-7
Aizazahmed-7 / DB27.226_microbiome_data.csv
Created May 7, 2024 11:12 — forked from baobabprince/DB27.226_microbiome_data.csv
Microbiome data for sample: DB27.226 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG
@absolutvodka8888
absolutvodka8888 / Kotlin clean code and best practices.md
Created April 11, 2024 05:47 — forked from limkhashing/Kotlin clean code and best practices.md
Kotlin clean code and best practices

Kotlin clean code and best practices

Clean Code Rules

Our main aim is to have a clean code, avoid common silly mistakes and reduce the load on engineers during PR reviews. This is a team effort and If anyone has something that’s generally applicable, let’s talk and decide whether it should be baked into our style guide— so everyone can benefit from it

The bad code creates a lot of distractions. It causes developers to waste time and energy navigating through functions, classes, and files, and pouring over code trying to understand it.

Working on a project where developers care about clean code makes it easy to understand its virtues; the developer can read the code from top to bottom in one go and clearly understand what it does. It makes code manageable and maintainable in the long term, isolating changes and increasing the efficiency of the team.

@dvf
dvf / change-codec.md
Last active May 7, 2024 12:42
Enable High Quality mode on your headphones (Updated for macOS Catalina)

If you're using a high-end bluetooth headset on your Macbook Pro it's likely your mac is using an audio codec which favors battery efficiency over high quality. This results in a drastic degradation of sound, the SBC codec is the likely culprit, read more about it here.

Find out what codec you're using

  1. Play a song on your headphones
  2. Option (⌥) click the Bluetooth button at the top of your screen Inspect the Bluetooth Coded
  3. If you're using AAC or aptX, you can stop here—those are the highest quality codecs.

Change your codec to AAC or aptX

@itewqq
itewqq / vscode-for-linux-kernel.md
Created February 19, 2023 14:37
Configure vscode for linux kernel source code
  1. Disable or uninstall the official C/C++ plugin.
  2. Install the clangd plugin.
  3. Build the kernel with clang:
/path/to/kernel_source$ make CC=clang defconfig
/path/to/kernel_source$ make CC=clang -j16
  1. Generate the compile_commands.json:
/path/to/kernel_source$ python ./scripts/clang-tools/gen_compile_commands.py
@fbarretto
fbarretto / streamdiffusion-mac.md
Last active May 7, 2024 12:38
StreamDiffusion on a Mac

This is a gist on how to get StreamDiffusion running on a Mac (mps)

  1. Clone the repo

git clone https://github.com/cumulo-autumn/StreamDiffusion.git

  1. Setup the environment

cd StreamDiffusion
@Tamal
Tamal / git-ssh-error-fix.sh
Last active May 7, 2024 12:41
Solution for 'ssh: connect to host github.com port 22: Connection timed out' error
$ git clone git@github.com:xxxxx/xxxx.git my-awesome-proj
Cloning into 'my-awesome-proj'...
ssh: connect to host github.com port 22: Connection timed out
fatal: Could not read from remote repository.
$ # This should also timeout
$ ssh -T git@github.com
ssh: connect to host github.com port 22: Connection timed out
$ # but this might work
@MWins
MWins / project-ideas01.md
Last active May 7, 2024 12:38
Back end Projects - list

Project Ideas

Ok. I'm going to list off some ideas for projects. You will have to determine if any particular idea is good enough to include in a portfolio. These aren't creative ideas. They likely already exist. Some are way too advanced while others are simplistic.

I will recommend to post any project you make to github and make a github project page for it. Explain in as much detail as possible how you made it, how it can be improved etc. Document it.

If you pick an advanced idea, setup a development roadmap and follow it. This will show some project management skills.

Another piece of advice for those who are design challenged. Use different front end frameworks and use different themes for those frameworks to provide appealing designs without looking like yet another bootstrap site.

@selcukcihan
selcukcihan / refactoring_ui.md
Created May 7, 2024 10:22
Notes from "Refactoring UI"

Refactoring UI

These are my notes from https://www.refactoringui.com

Starting

  • Start with a feature, not a layout. Details comes later, defer choices like color.
  • Establish a system (of choices): font size, weight, line height, colors, spacing, shadows etc.
  • Refrain from using font weights under 400 for UI work, to de-emphasize some text, use a lighter color or smaller font size instead.
@abdorrahmani
abdorrahmani / gist:baf8c1222cd9773a88cdcb51dcbf28b9
Created May 7, 2024 12:35
Laravel-React-Vite.js config file example
```
import { defineConfig} from 'vite';
import laravel from 'laravel-vite-plugin';
import react from '@vitejs/plugin-react-swc';
import viteCompression from 'vite-plugin-compression';
import viteImagemin from 'vite-plugin-imagemin';
export default defineConfig({
plugins: [
laravel({
@tomdyson
tomdyson / wagtail-import-data.md
Last active May 7, 2024 12:35
Create 35k Wagtail pages of Wikipedia film plots

Create Wagtail pages programmatically

This short recipe demonstrates how to create Wagtail pages programmatically. It may also be useful for testing Wagtail development against a reasonable volume of page data (about 35,000 film plots, from English Wikipedia).

Instructions

In a virtualenv: