Discover gists

SSH Cheat Sheet

This sheet goes along with this SSH YouTube tutorial

Login via SSH with password (LOCAL SERVER)

$ ssh brad@192.168.1.29

Create folder, file, install Apache (Just messing around)

$ mkdir test

$ cd test

Install Any PHP on Arch / Manjaro

Through the AUR it is possible to install older and newer PHP versions, simultaneously on the same system. I often had trouble installing using pacman and pamac so here's what I did:

mkdir -p $HOME/bin
mkdir ~/src
cd ~/src
git clone https://aur.archlinux.org/php81.git
cd php81

Backslash Escapes

https://daringfireball.net/projects/markdown/syntax#precode

syntax

\*literal asterisks\*

output

*literal asterisks*

I used to have a site bookmarked with a table of all these functions, but the link is dead. Here's a matrix of Option and Result conversion functions. These become second nature once you have used Rust for any significant length of time, but it's useful to have a table reference.

For each of the below:

T is the value possibly contained in an input Ok Result or Some Option.
U is a new value created by transforming or replacing an input T. Note that when U appears in methods like map, U ?= T, for example by calling

	# first:
	lsbom -f -l -s -pf /var/db/receipts/org.nodejs.pkg.bom \| while read f; do sudo rm /usr/local/${f}; done
	sudo rm -rf /usr/local/lib/node /usr/local/lib/node_modules /var/db/receipts/org.nodejs.*

	# To recap, the best way (I've found) to completely uninstall node + npm is to do the following:

	# go to /usr/local/lib and delete any node and node_modules
	cd /usr/local/lib
	sudo rm -rf node*

	---
	title: "The power of DRY"
	output: html_document
	---

	```{r setup, include=FALSE}
	knitr::opts_chunk$set(echo = FALSE)
	#rmarkdown::render("iwalk_script.Rmd")
	library(dplyr)
	library(forcats)

	Java.perform(function() {
	var surface_view = Java.use('android.view.SurfaceView');

	var set_secure = surface_view.setSecure.overload('boolean');

	set_secure.implementation = function(flag){
	console.log("setSecure() flag called with args: " + flag);
	set_secure.call(false);
	};

	<?php
	/**
	* get-pdoc.php - Scrape Canada Revenue Agency payroll deductions values
	*
	* This script takes an hourly amount, a number of hours, and a year,
	* month and day of a pay period ending, and passes these to the
	* Canada Revenue Agency Payroll Deductions Online Calculator
	* (https://www.canada.ca/en/revenue-agency/services/e-services/e-services-businesses/payroll-deductions-online-calculator.html),
	* returning the provincial tax, federal tax, CPP and EI amounts.
	*

	<?php
	# app/Http/Controllers/CaddyController.php

	namespace App\Http\Controllers;

	use App\Store;
	use Illuminate\Http\Request;

	class CaddyController extends Controller
	{

	"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
	"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG"
	"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG