Discover gists
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
int main() | |
{ | |
printf("Hello world"); | |
return 0; | |
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
defmodule RequestCache do | |
@moduledoc """ | |
Simple ETS-based cache. | |
""" | |
use GenServer | |
@type t :: %{ttl: integer, invalidators: %{}} | |
@type cache_key :: any | |
@type cache_value :: any | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// XORCipher - Super simple encryption using XOR and Base64 | |
// | |
// Depends on [Underscore](http://underscorejs.org/). | |
// | |
// As a warning, this is **not** a secure encryption algorythm. It uses a very | |
// simplistic keystore and will be easy to crack. | |
// | |
// The Base64 algorythm is a modification of the one used in phpjs.org | |
// * http://phpjs.org/functions/base64_encode/ | |
// * http://phpjs.org/functions/base64_decode/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# ZSH | |
sudo apt install zsh -y | |
sudo apt-get install powerline fonts-powerline -y | |
git clone https://github.com/robbyrussell/oh-my-zsh.git ~/.oh-my-zsh | |
cp ~/.oh-my-zsh/templates/zshrc.zsh-template ~/.zshrc | |
chsh -s /bin/zsh | |
# REBOOT | |
# sudo reboot |
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
description = "Python Packages Example"; | |
inputs = { | |
nixpkgs.url = "github:NixOS/nixpkgs/nixos-unstable"; | |
flake-utils.url = "github:numtide/flake-utils"; | |
}; | |
outputs = { self, nixpkgs, flake-utils }: | |
flake-utils.lib.eachDefaultSystem |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#____ ____ __ | |
#\ \ / /____ _____/ |_ ___________ | |
# \ Y // __ \_/ ___\ __\/ _ \_ __ \ | |
# \ /\ ___/\ \___| | ( <_> ) | \/ | |
# \___/ \___ >\___ >__| \____/|__| | |
# \/ \/ | |
#--Licensed under GNU GPL 3 | |
#----Authored by Vector/NullArray | |
# | |
# Do't forget to run this as well. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env bash | |
###################################################### | |
# ProtonVPN CLI | |
# ProtonVPN Command-Line Tool | |
# | |
# Made with <3 for Linux + macOS. | |
### | |
#Author: Mazin Ahmed <Mazin AT ProtonMail DOT ch> | |
###################################################### | |
version=1.1.2 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
RAR registration data | |
Hardik | |
www.Hardik.live | |
UID=448c4a899c6cdc1039c5 | |
641221225039c585fc5ef8da12ccf689780883109587752a828ff0 | |
59ae0579fe68942c97d160f361d16f96c8fe03f1f89c66abc25a37 | |
7777a27ec82f103b3d8e05dcefeaa45c71675ca822242858a1c897 | |
c57d0b0a3fe7ac36c517b1d2be385dcc726039e5f536439a806c35 | |
1e180e47e6bf51febac6eaae111343d85015dbd59ba45c71675ca8 | |
2224285927550547c74c826eade52bbdb578741acc1565af60e326 |
NewerOlder