See how a minor change to your commit message style can make you a better programmer.
Format: <type>(<scope>): <subject>
<scope> is optional
Discover gists
GrahamcOfBorg
/ Potential Maintainers
Created
May 7, 2024 11:19
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Maintainers: | |
| opna2608: furnace, furnace, furnace, furnace |
rench
/ XORCipher.js
Created
May 7, 2024 11:16
— forked from sukima/XORCipher.js
A Super simple encryption cipher using XOR and Base64 in JavaScript
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // XORCipher - Super simple encryption using XOR and Base64 | |
| // | |
| // Depends on [Underscore](http://underscorejs.org/). | |
| // | |
| // As a warning, this is **not** a secure encryption algorythm. It uses a very | |
| // simplistic keystore and will be easy to crack. | |
| // | |
| // The Base64 algorythm is a modification of the one used in phpjs.org | |
| // * http://phpjs.org/functions/base64_encode/ | |
| // * http://phpjs.org/functions/base64_decode/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| int main() | |
| { | |
| printf("Hello world"); | |
| return 0; | |
| } |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| defmodule RequestCache do | |
| @moduledoc """ | |
| Simple ETS-based cache. | |
| """ | |
| use GenServer | |
| @type t :: %{ttl: integer, invalidators: %{}} | |
| @type cache_key :: any | |
| @type cache_value :: any | |
coolaj86
/ ChatGPT-Dan-Jailbreak.md
Last active
May 7, 2024 11:15
sukima
/ XORCipher.js
Last active
May 7, 2024 11:16
A Super simple encryption cipher using XOR and Base64 in JavaScript
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // XORCipher - Super simple encryption using XOR and Base64 | |
| // | |
| // Depends on [Underscore](http://underscorejs.org/). | |
| // | |
| // As a warning, this is **not** a secure encryption algorythm. It uses a very | |
| // simplistic keystore and will be easy to crack. | |
| // | |
| // The Base64 algorythm is a modification of the one used in phpjs.org | |
| // * http://phpjs.org/functions/base64_encode/ | |
| // * http://phpjs.org/functions/base64_decode/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # ZSH | |
| sudo apt install zsh -y | |
| sudo apt-get install powerline fonts-powerline -y | |
| git clone https://github.com/robbyrussell/oh-my-zsh.git ~/.oh-my-zsh | |
| cp ~/.oh-my-zsh/templates/zshrc.zsh-template ~/.zshrc | |
| chsh -s /bin/zsh | |
| # REBOOT | |
| # sudo reboot |
baobabprince
/ DB27.226_microbiome_data.csv
Created
May 7, 2024 11:05
Microbiome data for sample: DB27.226 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.317892358258011,0.123966304244692,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__S24-7"," g__"," s__",0.110209531635168,0.0315770158898006,"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT","http://dbbact.org/search_results?sequence=TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| { | |
| description = "Python Packages Example"; | |
| inputs = { | |
| nixpkgs.url = "github:NixOS/nixpkgs/nixos-unstable"; | |
| flake-utils.url = "github:numtide/flake-utils"; | |
| }; | |
| outputs = { self, nixpkgs, flake-utils }: | |
| flake-utils.lib.eachDefaultSystem |
NewerOlder